Review

pet-22b expression plasmid (Bio Basic Canada)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Bio Basic Canada pet-22b expression plasmid
Pet 22b Expression Plasmid, supplied by Bio Basic Canada, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pet-22b+expression+plasmid/pet+22b+++++expression+plasmid/pm39418728-89-10-13
Average 90 stars, based on 1 article reviews

pet-22b expression plasmid - by Bioz Stars, 2026-09

90/100 stars

Images

Synthesized:

Article Title: Recombinant ClearColi™-derived outer membrane vesicles as an effective carrier for development of neoepitope-based vaccine candidate against colon carcinoma.
Article Snippet: Background: Colorectal carcinoma (CRC) is the third most common cancer worldwide, with high clonal heterogeneity due to somatic mutations.. Poly neoepitope vaccines can inhibit the tumor’s escape from the immune system.. However, they have rapid clearance and low immunogenicity.

Clone Assay:

Expressing:

Plasmid Preparation:

Image Search Results

(a) Representative images of expression levels of Synapsin 1 (Syn1, upper ) and Calbindin 1 (Calb1, lower ) show predominant (Syn1) or almost exclusive (Calb1) expression in Purkinje cells (pc) in the cerebellar cortex. Image credit: Allen Institute. Scale bar = 100 µm. (b) Fluorescent micrographs of Prnp ZH3/ZH3 COCS transduced with the AAV outlined in panel (A) show mNeonGreen expression predominantly in calbindin 1-expressing Purkinje cells. Scale bar = 50 µm. cgl = cerebellar internal granular layer, pc = Purkinje cell layer, ml = molecular layer. These findings were repeated in three independent experiments. (c) Left panel : Stably transfected CAD5-mPrP C and CAD5-mPrP R207A cells show similar PrP C expression levels. epresentative PrP C levels of one cell culture passage are shown. Right panel : POM19 immunoreactivity is divided by actin immunoreactivity, values are given as percentages of PrP C . One datapoint corresponds to one passage of CAD5 cells. (d) Surface plasmon resonance (SPR) traces showing binding of POM1 to recombinant mPrP R207A (rmPrP R207A , k a =3.8E +05 1/Ms, k d =1.8E −04 1/s, K D =4.7E −10 M; for comparison binding to recombinant wild-type murine PrP showed k a =3.6E +05 1/Ms; k d =9.1E −05 1/s; K D =2.5E −10 M). (e) Immunohistochemistry of CAD5 Prnp -/- cells stably transfected with pcDNA3.1 vector expressing wild-type murine PrP C (mPrP C ), mPrP R207A and mPrP 2cys . Monoclonal anti-PrP C antibodies targeting distinct conformational epitopes on the globular domain of PrP C were incubated to assess conformational changes in mPrP R207A (POM1: α1-α3, POM5: β2-α2, POM8: α1-α2, POM19: β1-α3). Except for diminished staining of POM1 in mPrP R207A , we observed robust detection of mPrP R207A by POM5, POM8 and POM19 and mPrP 2cys by POM8 and POM19. Parts of this experiment, for example POM1 and POM19, were repeated twice. Scale bar = 20 µm.

Journal: Nature Structural & Molecular Biology

Article Title: A conformational switch controlling the toxicity of the prion protein

doi: 10.1038/s41594-022-00814-7

Figure Lengend Snippet: (a) Representative images of expression levels of Synapsin 1 (Syn1, upper ) and Calbindin 1 (Calb1, lower ) show predominant (Syn1) or almost exclusive (Calb1) expression in Purkinje cells (pc) in the cerebellar cortex. Image credit: Allen Institute. Scale bar = 100 µm. (b) Fluorescent micrographs of Prnp ZH3/ZH3 COCS transduced with the AAV outlined in panel (A) show mNeonGreen expression predominantly in calbindin 1-expressing Purkinje cells. Scale bar = 50 µm. cgl = cerebellar internal granular layer, pc = Purkinje cell layer, ml = molecular layer. These findings were repeated in three independent experiments. (c) Left panel : Stably transfected CAD5-mPrP C and CAD5-mPrP R207A cells show similar PrP C expression levels. epresentative PrP C levels of one cell culture passage are shown. Right panel : POM19 immunoreactivity is divided by actin immunoreactivity, values are given as percentages of PrP C . One datapoint corresponds to one passage of CAD5 cells. (d) Surface plasmon resonance (SPR) traces showing binding of POM1 to recombinant mPrP R207A (rmPrP R207A , k a =3.8E +05 1/Ms, k d =1.8E −04 1/s, K D =4.7E −10 M; for comparison binding to recombinant wild-type murine PrP showed k a =3.6E +05 1/Ms; k d =9.1E −05 1/s; K D =2.5E −10 M). (e) Immunohistochemistry of CAD5 Prnp -/- cells stably transfected with pcDNA3.1 vector expressing wild-type murine PrP C (mPrP C ), mPrP R207A and mPrP 2cys . Monoclonal anti-PrP C antibodies targeting distinct conformational epitopes on the globular domain of PrP C were incubated to assess conformational changes in mPrP R207A (POM1: α1-α3, POM5: β2-α2, POM8: α1-α2, POM19: β1-α3). Except for diminished staining of POM1 in mPrP R207A , we observed robust detection of mPrP R207A by POM5, POM8 and POM19 and mPrP 2cys by POM8 and POM19. Parts of this experiment, for example POM1 and POM19, were repeated twice. Scale bar = 20 µm.

Article Snippet: For generation of POM1 mutants, we performed site-directed mutagenesis on a POM1 pET-22b(+) (Novagen) expression plasmid according to the manufacturer’s guidelines (primers (5′→3′): hc W33A: forward (FW): CATTCACTGACTACGCGATGCACTGGGTGAAGC, reverse (REV): GCTTCACCCAGTGCATCGCGTAGTCAGTGAATG. hc D52A: FW: GAGTGGATCGGATCGATTGCGCCTTCTGATAG, REV: CTATCAGAAGGCGCAATCGATCCGATCCACTC. hc D55A: FW GGATCGATTGATCCTTCTGCGAGTTATACTAGTCAC, REVGTGACTAGTATAACTCGCAGAAGGATCAATCGATCC. hc Y57A: FW: CCTTCTGATAGTGCGACTAGTCACAATGAAAAGTTCAAGG, REV: CCTTGAACTTTTCATTGTGACTAGTCGCACTATCAGAAGG. lc S32A: FW: CCAGTCAGAACATTGGCACAGCGATACACTGGTATCAGCAAAG, REV: CTTTGCTGATACCAGTGTATCGCTGTGCCAATGTTCTGACTGG. lc Y50A: FW: CTCCAAGGCTTATCATAAAGGCGGCTTCTGAGTCTATCTCTGG, REV: CCAGAGATAGACTCAGAAGCCGCCTTTATGATAAGCCTTGGAG. lc S91A: FW: CAGATTATTACTGTCAACAAGCTAATACCTGGCCGTACACGTT, REV: AACGTGTACGGCCAGGTATTAGCTTGTTGACAGTAATAATCTG. lc W94A: FW: GTCAACAAAGTAATACCGCGCCGTACACGTTCGGAGG, REV: CCTCCGAACGTGTACGGCGCGGTATTACTTTGTTGAC. lc Y96A: FW: TAATACCTGGCCGGCCACGTTCGGAGGGG, REV: CCCCTCCGAACGTGGCCGGCCAGGTATTA. hc Y101A: FW: CTGTTCAAGATCCGGCGCCGGATATTATGCTATGGAG, REV: CTCCATAGCATAATATCCGGCGCCGGATCTTGAACAG. hc Y104A: FW: CCGGCTACGGATATGCTGCTATGGAGTACTGGG, REV: CCCAGTACTCCATAGCAGCATATCCGTAGCCGG), followed by subsequent expression and purification as was described for holo-POM1.

Techniques: Expressing, Transduction, Stable Transfection, Transfection, Cell Culture, SPR Assay, Binding Assay, Recombinant, Immunohistochemistry, Plasmid Preparation, Incubation, Staining

a , Scheme of AAV used for bi-cistronic expression of monomeric NeonGreen and PrP C , separated by a P2A site (monomeric neon green (mNG)-P2A-PrP C ). hSyn1, human Synapsin 1 promoter. WRPE, woodchuck hepatitis virus regulatory posttranscriptional element. ITR, inverted terminal repeats. b , Robust expression of mNG-P2A-PrP C on fluorescent micrographs from transduced Prnp ZH3/ZH3 COCS. Scale bars: 500 µm. c , Holo-POM19–holo-POM2-biotin PrP C sandwich ELISA of samples depicted in b . One data point corresponds to a pool of 6–9 biological replicates of organotypic cultured slices. d , Proteinase K digestion of brain homogenates and cell lysates from chronically RML6-inoculated CAD5 cells (fourth passage is shown) detected with POM19. RML6 prions (lanes 1 and 2) and inoculated CAD5-mPrP C cells (lanes 7 and 8) show a typical ‘diagnostic shift’ of proteinase K (PK)-digested PrP Sc , whereas only trace amounts of PrP Sc are detectable in CAD5-mPrP R207A cells (lanes 5 and 6). Lack of detectable PrP Sc in CAD5 Prnp –/– (lanes 3 and 4) cells indicates no residual inoculum. Lanes are from non-adjacent samples blotted on the same membrane. e , Addition of POM1 causes toxicity to CAD5 cells (left) but not to Prnp –/– or mPrP R207A CAD5 cells (center and right). The percentage of propidium iodide (PI)-positive cells, determined by fluorescence-activated cell sorting (FACS), is shown on the y axis. Values are given as percentages of CAD5 mPrP C PI-positive cells without POM1. One data point corresponds to a biologically independent cell lysate, for example a different cell passage. n.s., not significant, adjusted P > 0.05, **adjusted P = 0.0083, ordinary, one-way analysis of variance (ANOVA) with Šídák’s multiple comparisons test. The FACS gating strategy is summarized in Extended Data Figure . f , Prnp ZH3/ZH3 COCS transduced with wild-type mPrP C are susceptible to POM1 toxicity, whereas COCS transduced with control vector (‘mNG control’) or mPrP R207A are not. Values are given as percentage of empty control. One data point corresponds to a biologically independent organotypic cultured slice. *adjusted P = 0.012, ordinary, one-way ANOVA with Šídák’s multiple comparisons test. Scale bar: 500 µm.

Journal: Nature Structural & Molecular Biology

Article Title: A conformational switch controlling the toxicity of the prion protein

doi: 10.1038/s41594-022-00814-7

Figure Lengend Snippet: a , Scheme of AAV used for bi-cistronic expression of monomeric NeonGreen and PrP C , separated by a P2A site (monomeric neon green (mNG)-P2A-PrP C ). hSyn1, human Synapsin 1 promoter. WRPE, woodchuck hepatitis virus regulatory posttranscriptional element. ITR, inverted terminal repeats. b , Robust expression of mNG-P2A-PrP C on fluorescent micrographs from transduced Prnp ZH3/ZH3 COCS. Scale bars: 500 µm. c , Holo-POM19–holo-POM2-biotin PrP C sandwich ELISA of samples depicted in b . One data point corresponds to a pool of 6–9 biological replicates of organotypic cultured slices. d , Proteinase K digestion of brain homogenates and cell lysates from chronically RML6-inoculated CAD5 cells (fourth passage is shown) detected with POM19. RML6 prions (lanes 1 and 2) and inoculated CAD5-mPrP C cells (lanes 7 and 8) show a typical ‘diagnostic shift’ of proteinase K (PK)-digested PrP Sc , whereas only trace amounts of PrP Sc are detectable in CAD5-mPrP R207A cells (lanes 5 and 6). Lack of detectable PrP Sc in CAD5 Prnp –/– (lanes 3 and 4) cells indicates no residual inoculum. Lanes are from non-adjacent samples blotted on the same membrane. e , Addition of POM1 causes toxicity to CAD5 cells (left) but not to Prnp –/– or mPrP R207A CAD5 cells (center and right). The percentage of propidium iodide (PI)-positive cells, determined by fluorescence-activated cell sorting (FACS), is shown on the y axis. Values are given as percentages of CAD5 mPrP C PI-positive cells without POM1. One data point corresponds to a biologically independent cell lysate, for example a different cell passage. n.s., not significant, adjusted P > 0.05, **adjusted P = 0.0083, ordinary, one-way analysis of variance (ANOVA) with Šídák’s multiple comparisons test. The FACS gating strategy is summarized in Extended Data Figure . f , Prnp ZH3/ZH3 COCS transduced with wild-type mPrP C are susceptible to POM1 toxicity, whereas COCS transduced with control vector (‘mNG control’) or mPrP R207A are not. Values are given as percentage of empty control. One data point corresponds to a biologically independent organotypic cultured slice. *adjusted P = 0.012, ordinary, one-way ANOVA with Šídák’s multiple comparisons test. Scale bar: 500 µm.

Techniques: Expressing, Sandwich ELISA, Cell Culture, Diagnostic Assay, Fluorescence, FACS, Transduction, Plasmid Preparation

a , b , 15 N-heteronuclear single quantum coherence spectra of rmPrP free (red) and mPrP 2cys (blue). Residues with different chemical shifts in the two spectra are colored orange on the GD structure in b , which resemble the H-latch conformation in the POM1–PrP complex. c , MD simulations show that mPrP 2cys resembles the PrP–POM1 complex, with increased flexibility in the α2–α3 and β2–α2 loops and decreased flexibility in the 2Cys region, corresponding to the POM1 epitope. d – f , Prnp ZH3/ZH3 COCS transduced with a bi-cistronic AAV expressing mNG and mPrP C (left) or mPrP 2Cys (right). See Extended Data Figure for quantification. Scale bars: 250 µm. d , mNG was visible in all COCS at 15 days post transduction (dpt, top row) but disappeared in mPrP 2Cys at 31 dpt (bottom row). e , Calbindin-1 + Purkinje cells were preserved at 15 dpt but became largely undetectable at 31 dpt, possibly as a result of mPrP 2Cys toxicity. f , Dose escalation of twice as many viral vectors as in d and e led to earlier onset of mPrP 2cys -mediated neurodegeneration. Significant neurodegeneration was observable at 15 dpt; see quantification in Extended Data Figure .

Journal: Nature Structural & Molecular Biology

Article Title: A conformational switch controlling the toxicity of the prion protein

doi: 10.1038/s41594-022-00814-7

Figure Lengend Snippet: a , b , 15 N-heteronuclear single quantum coherence spectra of rmPrP free (red) and mPrP 2cys (blue). Residues with different chemical shifts in the two spectra are colored orange on the GD structure in b , which resemble the H-latch conformation in the POM1–PrP complex. c , MD simulations show that mPrP 2cys resembles the PrP–POM1 complex, with increased flexibility in the α2–α3 and β2–α2 loops and decreased flexibility in the 2Cys region, corresponding to the POM1 epitope. d – f , Prnp ZH3/ZH3 COCS transduced with a bi-cistronic AAV expressing mNG and mPrP C (left) or mPrP 2Cys (right). See Extended Data Figure for quantification. Scale bars: 250 µm. d , mNG was visible in all COCS at 15 days post transduction (dpt, top row) but disappeared in mPrP 2Cys at 31 dpt (bottom row). e , Calbindin-1 + Purkinje cells were preserved at 15 dpt but became largely undetectable at 31 dpt, possibly as a result of mPrP 2Cys toxicity. f , Dose escalation of twice as many viral vectors as in d and e led to earlier onset of mPrP 2cys -mediated neurodegeneration. Significant neurodegeneration was observable at 15 dpt; see quantification in Extended Data Figure .

Techniques: Transduction, Expressing

Extended Data Figure 4. (a) MD simulations of POM1 binding and pathogenic PRNP mutations causing genetic prion disease show the R156-E196 interaction is abolished and induction of the H140-R208 H-latch is established. Each datapoint represents one independent simulation, values are given as mean ± standard deviation. (b) In agreement with this view, POM1 and human, hereditary PrP mutations responsible for fatal prion diseases favor altered flexibility in the α2-α3 and β2-α2 loop.

Journal: Nature Structural & Molecular Biology

Article Title: A conformational switch controlling the toxicity of the prion protein

doi: 10.1038/s41594-022-00814-7

Figure Lengend Snippet: Extended Data Figure 4. (a) MD simulations of POM1 binding and pathogenic PRNP mutations causing genetic prion disease show the R156-E196 interaction is abolished and induction of the H140-R208 H-latch is established. Each datapoint represents one independent simulation, values are given as mean ± standard deviation. (b) In agreement with this view, POM1 and human, hereditary PrP mutations responsible for fatal prion diseases favor altered flexibility in the α2-α3 and β2-α2 loop.

Techniques: Binding Assay, Standard Deviation

a , b , Binding of PrP C to the neurotoxic antibody POM1 favors the formation of a R208-H140 hydrogen bond in the GD of PrP C ( a ) that is absent from free PrP C ( b ). c , MD simulations indicate that toxic antibodies are more likely to induce the R208-H140 bond. Ordinate: percentage of simulation time in which the H-bond is present. See also Supplementary Figure . d , GD flexibility according to MD simulations. Narrow blue ribbons: rigidity; large green/red ribbons: increased flexibility. PrP bound to protective pomologs resembles free PrP. PrP bound to POM1 induces increased flexibility in the α2–α3 and β2–α2 loops. e , Binding of the toxic antibody POM1 to PrP induces local structural changes within the GD, here shown as a cartoon, both within and outside the epitope region. Side-chain contacts (less than 5 Å) that are present only in PrP free (blue, PDB 1xyx ) or PrP bound (orange, PDB 4H88 ) are indicated by lines. f , POM1 binding breaks the R156-E196 interaction, increasing α2–α3 flexibility, and induces the formation of a R156-D202 salt bridge. g , R156 interacts with E196 in free PrP, which helps to rigidify the α2–α3 loop.

Journal: Nature Structural & Molecular Biology

Article Title: A conformational switch controlling the toxicity of the prion protein

doi: 10.1038/s41594-022-00814-7

Figure Lengend Snippet: a , b , Binding of PrP C to the neurotoxic antibody POM1 favors the formation of a R208-H140 hydrogen bond in the GD of PrP C ( a ) that is absent from free PrP C ( b ). c , MD simulations indicate that toxic antibodies are more likely to induce the R208-H140 bond. Ordinate: percentage of simulation time in which the H-bond is present. See also Supplementary Figure . d , GD flexibility according to MD simulations. Narrow blue ribbons: rigidity; large green/red ribbons: increased flexibility. PrP bound to protective pomologs resembles free PrP. PrP bound to POM1 induces increased flexibility in the α2–α3 and β2–α2 loops. e , Binding of the toxic antibody POM1 to PrP induces local structural changes within the GD, here shown as a cartoon, both within and outside the epitope region. Side-chain contacts (less than 5 Å) that are present only in PrP free (blue, PDB 1xyx ) or PrP bound (orange, PDB 4H88 ) are indicated by lines. f , POM1 binding breaks the R156-E196 interaction, increasing α2–α3 flexibility, and induces the formation of a R156-D202 salt bridge. g , R156 interacts with E196 in free PrP, which helps to rigidify the α2–α3 loop.

Techniques: Binding Assay

1a ), we prepared 11 single mutations of POM1 (in each CDR loop) as scFv constructs. Colors (yellow to red) visualize the impact on binding affinity. The mutated residues are shown as sticks on the cartoon POM1 structure in Extended Data Figure 5b " width="100%" height="100%">

Journal: Nature Structural & Molecular Biology

Article Title: A conformational switch controlling the toxicity of the prion protein

doi: 10.1038/s41594-022-00814-7

Figure Lengend Snippet: a , Computational alanine scanning indicates which residues of POM1 and PrP contribute to binding. Positive numbers in the third column suggest loss of binding energy. b , On the basis of these results (Table 1a ), we prepared 11 single mutations of POM1 (in each CDR loop) as scFv constructs. Colors (yellow to red) visualize the impact on binding affinity. The mutated residues are shown as sticks on the cartoon POM1 structure in Extended Data Figure 5b

Techniques: Binding Assay, Construct

Extended Data Figure 5. (a) Intermolecular contacts between human PrP C 120–230 and POM1 Fab variable heavy chain (magenta, left panel ), and POM1 Fab variable light chain (green, r ight panel ) as determined by Baral et al., 2012 . Reproduced with permission of the International Union of Crystallography from doi:10.1107/S0907444912037328. (b) Schematic representation of a single-chain fragment of wild-type POM. The mutated residues are indicated as stick on the cartoon structure of POM1, color coded as in Supplementary Table . The CDR loops are shown from the perspective of the antigen. (c) Scheme of competition FRET assay to assess the K D of various pomologs. In the absence of competing antibody, FRET occurs due to proximity of allophycocyanin (APC)-labeled holo-POM3 and europium (Eu3+)-labeled POM1 ( left panel ). Because of liquid-phase competition, addition of unlabeled pomologs leads to a decrease in FRET signal ( right panel ). The calculation of binding constants from FRET is detailed in the methods section. (d) The binding constants measured by SPR and by FRET were in good agreement, Spearman r = 0.77, p=0.0074, 95% CI 0.30–0.94) with the exception of hc W33A, whose binding on SPR was too weak to be precisely measured.

Journal: Nature Structural & Molecular Biology

Article Title: A conformational switch controlling the toxicity of the prion protein

doi: 10.1038/s41594-022-00814-7

Figure Lengend Snippet: Extended Data Figure 5. (a) Intermolecular contacts between human PrP C 120–230 and POM1 Fab variable heavy chain (magenta, left panel ), and POM1 Fab variable light chain (green, r ight panel ) as determined by Baral et al., 2012 . Reproduced with permission of the International Union of Crystallography from doi:10.1107/S0907444912037328. (b) Schematic representation of a single-chain fragment of wild-type POM. The mutated residues are indicated as stick on the cartoon structure of POM1, color coded as in Supplementary Table . The CDR loops are shown from the perspective of the antigen. (c) Scheme of competition FRET assay to assess the K D of various pomologs. In the absence of competing antibody, FRET occurs due to proximity of allophycocyanin (APC)-labeled holo-POM3 and europium (Eu3+)-labeled POM1 ( left panel ). Because of liquid-phase competition, addition of unlabeled pomologs leads to a decrease in FRET signal ( right panel ). The calculation of binding constants from FRET is detailed in the methods section. (d) The binding constants measured by SPR and by FRET were in good agreement, Spearman r = 0.77, p=0.0074, 95% CI 0.30–0.94) with the exception of hc W33A, whose binding on SPR was too weak to be precisely measured.

Techniques: Labeling, Binding Assay

Extended Data Figure 6. (a) Treatment of Prnp ZH1/ZH1 COCS shows toxicity of POM1 and toxic pomologs to be dependent on PrP C , see also Supplementary Fig. . **: p=0.003, ordinary one-way Anova with Dunnett’s multiple comparisons test. Innocuous pomologs are highlighted in green, POM1 and toxic pomologs are highlighted in red. (b) Morphometric quantification of Prnp -overexpressing tga20 COCS treated with pomologs, see also Fig. . Color coding according to panel (A). 100%=untreated COCS, comparison of untreated versus treated groups. N.s.: not significant, ***: p < 0.0001, ** hc Y101A: p=0.0035, ** hc Y104A: p=0.0019, ordinary one-way Anova with Dunnett’s multiple comparisons test. (c) Morphometric quantification of fluorescence intensity from images depicted in Supplementary Fig. . §: 1 outlier was excluded (y=2046.3%, p < 0.05, extreme studentized deviate method). Values = % of untreated control. Pairwise comparison in the presence or absence of rmPrP 23–231 . ***: p < 0.0001, * GFAP-POM1: p=0.0148, ** GFAP- lc Y101A: p=0.0009, ** F4/80-POM1: p=0.0005, * F4/80- lc Y101A: p=0.0261, ordinary one-way Anova with Šídák’s multiple comparisons test. (d) Toxicity of high-affinity pomolog lc S32A ablated by POM2. 100%=POM1 + rmPrP 23–231 ( bars 1–4 ) or 100%= lc S32 + rmPrP 23–231 ( bars 5–7 ). ** p=0.0003, *** p < 0.0001, ordinary one-way Anova with Šídák’s multiple comparisons test. (e) Titration of minimal toxic dosage of POM1 in tga20 COCS. 100%=POM1 + rmPrP 23–231 . ***: p < 0.0001, ordinary one-way Anova with Dunnett’s multiple comparisons test. (f) hc Y104A prevented POM1-induced toxicity. 100%= Prnp 0/0 COCS treated with POM1 + hc Y104A. ** p=0.0078, ***(left): p=0.0009, ***(right): p < 0.0001, ordinary one-way Anova with Dunnett’s multiple comparisons test. (g) Quantification of Fig. . 100%=untreated+NBH. ***: p < 0.0001, ordinary one-way Anova with Dunnett’s multiple comparisons test. (h) Quantification of Fig. . 100% = Prnp ZH3/ZH3 + 22 L. *: p=0.032, ordinary one-way Anova with Šídák’s multiple comparisons test. (i) Quantification of Fig. . 100%=untreated+NBH. *: p=0.0203, **(left): p=0.0036, **(right): p=0.005, ordinary one-way Anova with Dunnett’s multiple comparisons test. All graphs: one datapoint corresponds to one biological replicate.

Journal: Nature Structural & Molecular Biology

Article Title: A conformational switch controlling the toxicity of the prion protein

doi: 10.1038/s41594-022-00814-7

Figure Lengend Snippet: Extended Data Figure 6. (a) Treatment of Prnp ZH1/ZH1 COCS shows toxicity of POM1 and toxic pomologs to be dependent on PrP C , see also Supplementary Fig. . **: p=0.003, ordinary one-way Anova with Dunnett’s multiple comparisons test. Innocuous pomologs are highlighted in green, POM1 and toxic pomologs are highlighted in red. (b) Morphometric quantification of Prnp -overexpressing tga20 COCS treated with pomologs, see also Fig. . Color coding according to panel (A). 100%=untreated COCS, comparison of untreated versus treated groups. N.s.: not significant, ***: p < 0.0001, ** hc Y101A: p=0.0035, ** hc Y104A: p=0.0019, ordinary one-way Anova with Dunnett’s multiple comparisons test. (c) Morphometric quantification of fluorescence intensity from images depicted in Supplementary Fig. . §: 1 outlier was excluded (y=2046.3%, p < 0.05, extreme studentized deviate method). Values = % of untreated control. Pairwise comparison in the presence or absence of rmPrP 23–231 . ***: p < 0.0001, * GFAP-POM1: p=0.0148, ** GFAP- lc Y101A: p=0.0009, ** F4/80-POM1: p=0.0005, * F4/80- lc Y101A: p=0.0261, ordinary one-way Anova with Šídák’s multiple comparisons test. (d) Toxicity of high-affinity pomolog lc S32A ablated by POM2. 100%=POM1 + rmPrP 23–231 ( bars 1–4 ) or 100%= lc S32 + rmPrP 23–231 ( bars 5–7 ). ** p=0.0003, *** p < 0.0001, ordinary one-way Anova with Šídák’s multiple comparisons test. (e) Titration of minimal toxic dosage of POM1 in tga20 COCS. 100%=POM1 + rmPrP 23–231 . ***: p < 0.0001, ordinary one-way Anova with Dunnett’s multiple comparisons test. (f) hc Y104A prevented POM1-induced toxicity. 100%= Prnp 0/0 COCS treated with POM1 + hc Y104A. ** p=0.0078, ***(left): p=0.0009, ***(right): p < 0.0001, ordinary one-way Anova with Dunnett’s multiple comparisons test. (g) Quantification of Fig. . 100%=untreated+NBH. ***: p < 0.0001, ordinary one-way Anova with Dunnett’s multiple comparisons test. (h) Quantification of Fig. . 100% = Prnp ZH3/ZH3 + 22 L. *: p=0.032, ordinary one-way Anova with Šídák’s multiple comparisons test. (i) Quantification of Fig. . 100%=untreated+NBH. *: p=0.0203, **(left): p=0.0036, **(right): p=0.005, ordinary one-way Anova with Dunnett’s multiple comparisons test. All graphs: one datapoint corresponds to one biological replicate.

Techniques: Fluorescence, Titration

a , The densely cellular NeuN + DAPI + cerebellar granule cell layer (CGL) of tga20 COCS was preserved by treatment with POM1 mutant hc Y104A (green) but destroyed by POM1 and hc D52A (red). b , CGL degeneration occurs in prion-infected tga20 COCS, but not in COCS exposed to non-infectious brain homogenate (NBH). Treatment of RML6 prion-infected tga20 COCS with hc Y104A prevented neuronal loss. c , Rescue of prion-induced toxicity by hc Y104A in COCS inoculated with 22L prions. d , Treatment of prion-infected wild-type COCS, expressing wild-type levels of PrP C , with hc Y104A prevented CGL degeneration. a – d , Quantification of fluorescent micrographs is depicted in Extended Data Figure . Scale bar: 500 µm. e , Treatment with hc Y104A (180 nM; 5 days) reduced vacuolation in chronically prion-infected Gt1 cells. Each dot represents an independent experiment with cells from different passages (1,000 cells/experiment, ordinary one-way ANOVA with Dunnett’s multiple comparisons test, ****adjusted P < 0.0001). f , Treatment of prion-infected tga20 COCS with hc Y104A led to a reduction in PrP Sc levels. One lane corresponds to a pool of 6–9 COCS digested with PK; PrP Sc was detected using holo-POM1. The dashed bar indicates gel splicing of lanes running in non-adjacent wells on the same gel. g , Treatment of tga20 COCS with hc Y104A for 7 days did not reduce PrP C levels, as determined by PrP C sandwich ELISA. §870 pM of rmPrP 23230 were used as a positive control (first lane). Pomologs were pre-incubated with 600 nM of rmPrP 23–230 as negative controls (last lane). Ordinate: absorbance, given as optical density at λ = 450 nm.

Journal: Nature Structural & Molecular Biology

Article Title: A conformational switch controlling the toxicity of the prion protein

doi: 10.1038/s41594-022-00814-7

Figure Lengend Snippet: a , The densely cellular NeuN + DAPI + cerebellar granule cell layer (CGL) of tga20 COCS was preserved by treatment with POM1 mutant hc Y104A (green) but destroyed by POM1 and hc D52A (red). b , CGL degeneration occurs in prion-infected tga20 COCS, but not in COCS exposed to non-infectious brain homogenate (NBH). Treatment of RML6 prion-infected tga20 COCS with hc Y104A prevented neuronal loss. c , Rescue of prion-induced toxicity by hc Y104A in COCS inoculated with 22L prions. d , Treatment of prion-infected wild-type COCS, expressing wild-type levels of PrP C , with hc Y104A prevented CGL degeneration. a – d , Quantification of fluorescent micrographs is depicted in Extended Data Figure . Scale bar: 500 µm. e , Treatment with hc Y104A (180 nM; 5 days) reduced vacuolation in chronically prion-infected Gt1 cells. Each dot represents an independent experiment with cells from different passages (1,000 cells/experiment, ordinary one-way ANOVA with Dunnett’s multiple comparisons test, ****adjusted P < 0.0001). f , Treatment of prion-infected tga20 COCS with hc Y104A led to a reduction in PrP Sc levels. One lane corresponds to a pool of 6–9 COCS digested with PK; PrP Sc was detected using holo-POM1. The dashed bar indicates gel splicing of lanes running in non-adjacent wells on the same gel. g , Treatment of tga20 COCS with hc Y104A for 7 days did not reduce PrP C levels, as determined by PrP C sandwich ELISA. §870 pM of rmPrP 23230 were used as a positive control (first lane). Pomologs were pre-incubated with 600 nM of rmPrP 23–230 as negative controls (last lane). Ordinate: absorbance, given as optical density at λ = 450 nm.

Techniques: Mutagenesis, Infection, Expressing, Sandwich ELISA, Positive Control, Incubation

The simulation of the PrP-POM1 complex (red) in reproduced in all charts to facilitate comparisons. When PrP is bound to POM1, the H-bond between R207 and H139 (termed H-latch) is always present, with distance between the centroid of their sidechains around 0.3 nm. Greater distances indicate loss of hydrogen interactions and consequently absence of the H-latch. The complex of PrP with the hc Y104A pomolog never shows formation of the H-latch, whereas FabA10 shows intermediate values. Simulations were run three times, but only representative traces are shown; aggregated analyses are shown in Fig. .

Journal: Nature Structural & Molecular Biology

Article Title: A conformational switch controlling the toxicity of the prion protein

doi: 10.1038/s41594-022-00814-7

Figure Lengend Snippet: The simulation of the PrP-POM1 complex (red) in reproduced in all charts to facilitate comparisons. When PrP is bound to POM1, the H-bond between R207 and H139 (termed H-latch) is always present, with distance between the centroid of their sidechains around 0.3 nm. Greater distances indicate loss of hydrogen interactions and consequently absence of the H-latch. The complex of PrP with the hc Y104A pomolog never shows formation of the H-latch, whereas FabA10 shows intermediate values. Simulations were run three times, but only representative traces are shown; aggregated analyses are shown in Fig. .

Techniques:

a , Comparison between the [ 15 N, 1 H]-TROSY spectra of free rmPrP 90–231 versus that bound to the hc Y104A pomolog. Chemical-shift differences, reflecting subtle alterations of the local chemical structure, were visible not only in the epitope but also at distant sites in the GD and FT. Residues affected by antibody binding are in color on PrP C (GD and part of the FT are shown on a MD model of PrP). Differences between toxic and protective antibodies are evident in the α2–α3 loop (the Y104A complex is identical to free PrP C ) and in the FT region closer to the GD. b , Content of secondary structure estimated from CD spectra of the rmPrP–pomologs complexes. ‘Calculated’ indicates the secondary structure content if the rmPrP and pomolog did not change upon binding. POM1 displayed increased content of irregular structure (measured versus calculated) when in complex with full rmPrP 23–231 , but identical content when in complex with a construct lacking the FT (rmPrP 90–231 ). This indicates that the FT changes conformation upon POM1 binding. Conversely, no differences were detected with the protective pomolog hc Y104A.

Journal: Nature Structural & Molecular Biology

Article Title: A conformational switch controlling the toxicity of the prion protein

doi: 10.1038/s41594-022-00814-7

Figure Lengend Snippet: a , Comparison between the [ 15 N, 1 H]-TROSY spectra of free rmPrP 90–231 versus that bound to the hc Y104A pomolog. Chemical-shift differences, reflecting subtle alterations of the local chemical structure, were visible not only in the epitope but also at distant sites in the GD and FT. Residues affected by antibody binding are in color on PrP C (GD and part of the FT are shown on a MD model of PrP). Differences between toxic and protective antibodies are evident in the α2–α3 loop (the Y104A complex is identical to free PrP C ) and in the FT region closer to the GD. b , Content of secondary structure estimated from CD spectra of the rmPrP–pomologs complexes. ‘Calculated’ indicates the secondary structure content if the rmPrP and pomolog did not change upon binding. POM1 displayed increased content of irregular structure (measured versus calculated) when in complex with full rmPrP 23–231 , but identical content when in complex with a construct lacking the FT (rmPrP 90–231 ). This indicates that the FT changes conformation upon POM1 binding. Conversely, no differences were detected with the protective pomolog hc Y104A.

Techniques: Binding Assay, Construct

a , Representative magnetic resonance diffusion-weighted images (DWI) 24 hours after stereotactic injection of holo- hc Y104A (left). Contralateral injections of holo- hc Y104A + rmPrP 23231 (right). A small area of hyperintensity was found in one mouse after injection of 12 µg holo- hc Y104A (white arrowhead). White asterisks: needle tract. b , Hematoxylin and eosin (HE)-stained sections from mice shown in a . Asterisks: needle tract. Rectangles denote regions magnified in c . c , HE sections (CA4). Left, holo- hc Y104A injections (6, 9 and 12 µg). Right, holo- hc Y104A + rmPrP 23–230 . Asterisk (9 µg): neurons with hypereosinophilic cytoplasm and nuclear condensation in the vicinity of the needle tract. Asterisk (12 µg): These neurons were diffusely distributed among numerous healthy neurons. White arrowhead: vacuoles indicative of edema along the needle tract. d , DWI images of 6 µg holo-POM1 ± rmPrP 23–231 , revealing a hyperintense signal at 24 hours. e , HE-stained section from a mouse shown in d . Asterisks: needle tract. Rectangles: areas in f . f , HE sections (CA4). Holo-POM1 injections revealed damaged neurons with condensed chromatin and hypereosinophilc cytoplasm. g , Volumetric quantification of lesions on DWI imaging 24 hours after injection revealed no significant lesion induction by holo- hc Y104A. One datapoint corresponds to an animal. P values are adjusted for multiple comparisons. n.s.: not significant, P > 0.05, ordinary one-way ANOVA with Šídák’s multiple comparisons test. h , Antibody expression levels, as determined by Myc-Tag western blot, showed a positive correlation with survival. One datapoint corresponds to one animal. Pearson correlation coefficient r = 0.72, 95% confidence interval 0.099–0.94, P = 0.03. a.u., arbitrary units. i , Significant correlation of PrP Sc and antibody expression levels (representative images depicted in j , aggregated correlation across all brain regions). Different colors represent 3 brain regions from 9 independent animals. Pearson correlation coefficient r = 0.53, 95% confidence interval 0.18–0.76, P = 0.0048. j , Representative images from quantification of l . l , Sagittal brain sections stained with SAF84, highlighting PrP Sc , and basal ganglia immunofluorescent micrographs marking hc Y104A-Myc-tag. Scale bar SAF84: 1 mm. Scale bar hc Y104A-Myc-tag: 500 µm.

Journal: Nature Structural & Molecular Biology

Article Title: A conformational switch controlling the toxicity of the prion protein

doi: 10.1038/s41594-022-00814-7

Figure Lengend Snippet: a , Representative magnetic resonance diffusion-weighted images (DWI) 24 hours after stereotactic injection of holo- hc Y104A (left). Contralateral injections of holo- hc Y104A + rmPrP 23231 (right). A small area of hyperintensity was found in one mouse after injection of 12 µg holo- hc Y104A (white arrowhead). White asterisks: needle tract. b , Hematoxylin and eosin (HE)-stained sections from mice shown in a . Asterisks: needle tract. Rectangles denote regions magnified in c . c , HE sections (CA4). Left, holo- hc Y104A injections (6, 9 and 12 µg). Right, holo- hc Y104A + rmPrP 23–230 . Asterisk (9 µg): neurons with hypereosinophilic cytoplasm and nuclear condensation in the vicinity of the needle tract. Asterisk (12 µg): These neurons were diffusely distributed among numerous healthy neurons. White arrowhead: vacuoles indicative of edema along the needle tract. d , DWI images of 6 µg holo-POM1 ± rmPrP 23–231 , revealing a hyperintense signal at 24 hours. e , HE-stained section from a mouse shown in d . Asterisks: needle tract. Rectangles: areas in f . f , HE sections (CA4). Holo-POM1 injections revealed damaged neurons with condensed chromatin and hypereosinophilc cytoplasm. g , Volumetric quantification of lesions on DWI imaging 24 hours after injection revealed no significant lesion induction by holo- hc Y104A. One datapoint corresponds to an animal. P values are adjusted for multiple comparisons. n.s.: not significant, P > 0.05, ordinary one-way ANOVA with Šídák’s multiple comparisons test. h , Antibody expression levels, as determined by Myc-Tag western blot, showed a positive correlation with survival. One datapoint corresponds to one animal. Pearson correlation coefficient r = 0.72, 95% confidence interval 0.099–0.94, P = 0.03. a.u., arbitrary units. i , Significant correlation of PrP Sc and antibody expression levels (representative images depicted in j , aggregated correlation across all brain regions). Different colors represent 3 brain regions from 9 independent animals. Pearson correlation coefficient r = 0.53, 95% confidence interval 0.18–0.76, P = 0.0048. j , Representative images from quantification of l . l , Sagittal brain sections stained with SAF84, highlighting PrP Sc , and basal ganglia immunofluorescent micrographs marking hc Y104A-Myc-tag. Scale bar SAF84: 1 mm. Scale bar hc Y104A-Myc-tag: 500 µm.

Techniques: Diffusion-based Assay, Injection, Staining, Imaging, Expressing, Western Blot

Extended Data Figure 7. ( a ) Photomicrographs of glial fibrillary acid protein (GFAP) immunohistochemistry on consecutive sections depicted in Fig. . Left column : holo- hc Y104A injections (6, 9 and 12 µg). Right column : holo- hc Y104A + rmPrP 23–231 . GFAP immunoreaction was increased in areas of neuronal damage ( white asterisks ) and around needle tracts ( white arrowheads ). ( b ) Micrographs demonstrating an intensive GFAP immunoreaction in areas with extensive holo-POM1 (6 µg)- induced neurotoxicity. Left panel : POM1 injection (6 µg). Right panel : holo- hc Y104A + rmPrP 23–231 . Sections are consecutive to those shown in Fig. .

Journal: Nature Structural & Molecular Biology

Article Title: A conformational switch controlling the toxicity of the prion protein

doi: 10.1038/s41594-022-00814-7

Figure Lengend Snippet: Extended Data Figure 7. ( a ) Photomicrographs of glial fibrillary acid protein (GFAP) immunohistochemistry on consecutive sections depicted in Fig. . Left column : holo- hc Y104A injections (6, 9 and 12 µg). Right column : holo- hc Y104A + rmPrP 23–231 . GFAP immunoreaction was increased in areas of neuronal damage ( white asterisks ) and around needle tracts ( white arrowheads ). ( b ) Micrographs demonstrating an intensive GFAP immunoreaction in areas with extensive holo-POM1 (6 µg)- induced neurotoxicity. Left panel : POM1 injection (6 µg). Right panel : holo- hc Y104A + rmPrP 23–231 . Sections are consecutive to those shown in Fig. .

Techniques: Immunohistochemistry, Injection

a , Preferential binding of the selected Fabs to rmPrP 23–231 over rmPrP 2Cys . With the exception of FabE2, the Fabs show higher apparent affinity for rmPrP 23–231 than rmPrP 2Cys . One datapoint corresponds to the mean ± s.e.m. of two technical replicates. The experiment was repeated twice. b , FabA10 and FabD9 conferred neuroprotection in prion-infected tga20 COCS. c , Quantification of NeuN fluorescence intensity from b , expressed as percentage of untreated (–) NBH. Scale bar: 500 µm. One datapoint corresponds to an independent, organotypic cultured slice. Two-way ANOVA with Dunnett’s multiple comparison test, P values are adjusted for multiple testing: RML untreated (–) versus RML A10: P = 0.006, RML untreated (–) versus RML D9: P = 0.009, ** P < 0.01, n.s.: not significant, P > 0.05. d , Structure of PrP C (white) in complex with FabA10 (violet) obtained by NMR-validated docking and MD. mPrP 90–231 residues whose NMR signal is affected by FabA10 binding are colored blue; residues with no NMR information are gray; residues mutated to Cys are yellow. e , There is partial overlap (green) between the epitopes of POM1 (red) and FabA10 (blue). The 2Cys are in yellow. PrP C is depicted in different orientations in d and e .

Journal: Nature Structural & Molecular Biology

Article Title: A conformational switch controlling the toxicity of the prion protein

doi: 10.1038/s41594-022-00814-7

Figure Lengend Snippet: a , Preferential binding of the selected Fabs to rmPrP 23–231 over rmPrP 2Cys . With the exception of FabE2, the Fabs show higher apparent affinity for rmPrP 23–231 than rmPrP 2Cys . One datapoint corresponds to the mean ± s.e.m. of two technical replicates. The experiment was repeated twice. b , FabA10 and FabD9 conferred neuroprotection in prion-infected tga20 COCS. c , Quantification of NeuN fluorescence intensity from b , expressed as percentage of untreated (–) NBH. Scale bar: 500 µm. One datapoint corresponds to an independent, organotypic cultured slice. Two-way ANOVA with Dunnett’s multiple comparison test, P values are adjusted for multiple testing: RML untreated (–) versus RML A10: P = 0.006, RML untreated (–) versus RML D9: P = 0.009, ** P < 0.01, n.s.: not significant, P > 0.05. d , Structure of PrP C (white) in complex with FabA10 (violet) obtained by NMR-validated docking and MD. mPrP 90–231 residues whose NMR signal is affected by FabA10 binding are colored blue; residues with no NMR information are gray; residues mutated to Cys are yellow. e , There is partial overlap (green) between the epitopes of POM1 (red) and FabA10 (blue). The 2Cys are in yellow. PrP C is depicted in different orientations in d and e .

Techniques: Binding Assay, Infection, Fluorescence, Cell Culture

Extended Data Figure 10. (a) The R208-H140 interaction is present in POM1-bound PrP (right, red ) but not in free PrP (left, white ) or in its complex with FabA10 (left, blue ). The final state of MD simulations starting from a POM1-bound conformation, with R208-H140 interaction present, is shown for FabA10. (b) Overlap (green) of FabA10 (blue) and POM1 (red) epitopes on murine PrP C -GD. Coloring according to Fig. .

Journal: Nature Structural & Molecular Biology

Article Title: A conformational switch controlling the toxicity of the prion protein

doi: 10.1038/s41594-022-00814-7

Figure Lengend Snippet: Extended Data Figure 10. (a) The R208-H140 interaction is present in POM1-bound PrP (right, red ) but not in free PrP (left, white ) or in its complex with FabA10 (left, blue ). The final state of MD simulations starting from a POM1-bound conformation, with R208-H140 interaction present, is shown for FabA10. (b) Overlap (green) of FabA10 (blue) and POM1 (red) epitopes on murine PrP C -GD. Coloring according to Fig. .

Techniques:

Review

pet-22b expression plasmid (Bio Basic Canada)

Structured Review

Images

Related Articles

Synthesized:

Clone Assay:

Expressing:

Plasmid Preparation:

Similar Products

Image Search Results